Enhanced Immunogenicity of Modified Hepatitis B Virus Core Particle Fused with Multiepitopes of Foot-and-Mouth Disease Virus

Y.-L. Zhang, Y.-J. Guo, K.-Y. Wang, K. Lu, K. Li, Y. Zhu & S.-H. Sun

Department of Medical Genetics, Second Military Medical University, Shanghai, China

Received 11 October 2006; Accepted in revised form 15 December 2006

Correspondence to: S.-H. Sun, Department of Medical Genetics, Second Military Medical University, 800 Xiang’Yin Road, Shanghai 200433, China. E-mail: shsun@vip.sina.com

Abstract

Hepatitis B virus core (HBc) particles, self-assemble into capsid particles and are extremely immunogenic, hold promise as an immune-enhancing vaccine carrier for heterologous antigens. However, formation of virus-like particles (VLP) can be restricted by size and structure of heterlogous antigens. In the study, we investigated formation of VLP by modified HBc fused with specified foot-and-mouth disease virus (FMDV) multiepitopes and evaluated their immune effects. Firstly, three HBc display vectors (pHBc1, pHBc2 and pHBc3) were constructed by deletions of different lengths within the HBc c/e1 region: 75–78 amino acid (aa), 75–80 aa and 75–82 aa respectively. Sec- ondly, we inserted different compositions of FMDV multiepitopes, BT [VP1(141–160)–VP4(21–40)] and BTB [VP1(141–160)–VP4(21–40)– VP1(141–160)], into modified regions. As a result, only plasmid pHBc3-BTB of six recombinant vectors was expressed as soluble protein, which resulted in the formation of complete VLP confirmed by electron microscopy. Recombin- ant VLP could be taken up by cells and presented in vitro and in vivo. Further- more, the modified VLP displayed a significantly stronger immunogenicity than other five recombinant proteins and GST-BTB with a higher titer of pep- tide-specific and virus-specific antibody, elevated IFN-c and interleukin-4 pro- duction, especially enhanced lymphocyte proliferation. The results encourage further work towards the development of FMDV vaccines using hepatitis B virus core particles fused with FMDV epitopes.

Introduction

The icosahedral nucleocapsids of hepatitis B virus (HBV), serologically defined as HBcAg, consist of 180 (triangula- tion number, T 1⁄4 3) or 240 subunits (T 1⁄4 4) of a single 183-amino acid (aa) core protein. The first 140 aa are suffi- cient for particle assembly [1, 2], the dispensable C ter- minal region is rich in Arg residues and binds to nucleic acids [3–5]. Hepatitis B core particles were firstly reported as a promising virus-like particle (VLP) carrier in 1986 [6]. Being one the first VLP candidates and the first icosa- hedral VLP carrier, the HBc particles remain the most flexible and the most promising model for knowledge- based display of foreign peptide sequences up to now. In many ways, HBc holds a unique position among other VLP carriers because of its high-level expression and effi- cient particle formation in virtually all known homologous and heterologous expression systems, including bacteria.

The small loop connecting the central helices overlap- ping the c/e1 epitopes has been identified as a superior site for insertion of heterologous sequences. While some short peptide inserts were tolerated, attempts to insert FMDV VP1(141–160 aa) frequently abolished VLP for- mation, suggesting that the loop has a naturally limited property of inserted fragment [7, 8].

Special interest is now devoted to construction of HBc display vectors with deletions of different lengths within c/e1 region (major immunogenic region, MIR), such as aa 76–80 [9–12], aa 79–80 [13, 14]. Structural and numerous experimental [15–17] data convinced us that the region between the two conserved glycines G73 and G94 can be used as target for deletions, rearrangements and substitutions. For optimal immunogenicity of the insert, it is extremely important that deleting proper aa residues within this region abrogate the intrinsic HBc antigenicity/immunogenicity [16, 17].

Ó 2007 The Authors 320 Journal compilation Ó 2007 Blackwell Publishing Ltd. Scandinavian Journal of Immunology 65, 320–328

Y.-L. Zhang et al. Modified HBc Fused with FMDV Multiepitopes 321..................................................................................................................................................................

Foot-and-mouth disease virus (FMDV) is the causative agent of one of the most transmissible diseases of live stock, which causes severe outbreaks and important eco- nomic losses worldwide [18–20]. This picornavirus is composed of a single RNA strand and a capsid assembled from 60 units of the four structural proteins designated VP1, 2, 3 and 4 respectively [21, 22]. Five sites contain- ing B-cell epitopes were defined on these proteins through monoclonal antibody escape mutant studies [23, 24]. Site 1 is the predominant site encoding two VP1 epitopes (residues 141–160 and 200–213 of VP1), which was able to protect animals from viral attack [25]. Epi- tope141-160 is linear, so it is easy to be mimicked for site 1 than other four sites that are conformational or less conformational dependent. Two major T helper epitopes identified in natural hosts, which are located in the non-structural protein 3A (T3A) [26] and in the VP4 structural protein (TVP4) [27, 28]. The latter epitope (aa 21–40) is an ideal candidate to be included in a vaccine formulation against FMDV as it seems to be recognized not only in natural hosts but also in BALB/c mice [29].

Here, we constructed three display vectors by modifi- cation of HBc to enhance capacity of displaying heterolo- gous fragment. Meanwhile, two different multiepitopes BT[VP1(141–160)–VP4(21–40)] and BTB [VP1(141– 160)–VP4(21–40)–VP1(141–160)] were synthetized. Recombinant plasmids were expressed to obtain proteins in Escherichia coli. The structure and immunogenicity of six proteins were investigated. Furthermore, the mecha-

nisms of immunopotentiation were also researched in this study.

Materials and methods

Construction of expression vectors. Six plasmids were con- structed in frame with HBc to investigate the structure and immune effect of HBc chimeric proteins. These plas- mids encode a truncated HBc gene (aa 1–144) with the tandem epitopes (BT or BTB) inserted in the HBc c/e1 region between aa 74 and 79, 74 and 81, 74 and 83 respectively (Fig. 1). HBc particles engineered to present heterologous epitopes have historically been truncated at, or around, aa 144 to avoid incorporation of host RNA by the protamine rich C-terminal tail (aa 150–183).

Display vectors (pHBc1, pHBc2 and pHBc3) were constructed as follows. First, the amino terminus of the pMD-HBc containing truncated HBc gene (aa 1–144) was amplified using two PCR primers to produce a dsDNA fragment corresponding to HBc aa 1–74, flanked with NcoI and BbeI restriction sites. The PCR primers used for amplification were HBc-P1/NcoI-F (5¢-CATGC- CATGGATGGACATTGACCCG) and HBc-P74/BbeI-R (5¢-ATTACTTCCCACCCAGGTGGGGCGCC). A plas- mid pBAD1 was constructed when the PCR fragment was inserted into plasmid pBAD, which had been pre- pared by cutting with the same two restriction enzymes (NcoI and BbeI). Second, The C-terminal of pMD-HBc was amplified, respectively, using four PCR primers to

Figure 1 Schematic presentation of the chimeric HBc/FMDV constructs used in the study.

Ó 2007 The Authors
Journal compilation Ó 2007 Blackwell Publishing Ltd. Scandinavian Journal of Immunology 65, 320–328

322 Modified HBc Fused with FMDV Multiepitopes Y.-L. Zhang et al...................................................................................................................................................................

produce three dsDNA fragments corresponding to HBc aa 79–144, 81–144 and 83–144, flanked with BbeI_Sac1 and Xho1. The primers were HBc-P79/BbeI_Sac1- F(GGCGCCGAGCTCGCATCCAGGGAATTAG), HBc- P81/BbeI_Sac1-F(GGCGCCGAGCTCAGGGAATTAGTAG), HBc-P83/BbeI_Sac1-F(GGCGCCGAGCTCTTAGTAGT- CAGCTATG) and HBc-P144/Xho1-R (CGGAAGTGTT- GATAAGATAGCTCGAGGG). The three PCR fragments were inserted, respectively, into pBAD1, which had been prepared by the same two restriction enzymes (BbeI and Xho1). Then, the pHBc1, pHBc2 and pHBc3 were constructed.

DNAworks2.4 [30], automatic oligonucleotide design for PCR-based gene synthesis, was applied to synthesize multiepitopes BT and BTB. Meanwhile, some flexibility linkers were inserted into epitopes bilateralis.

At last, multiepitopes, BT and BTB, were inserted into pHBc1, pHBc2 and pHBc3 to construct six recom- binant plasmids pHBc1-BT, pHBc2-BT, pHBc3-BT, pHBc1-BTB, pHBc2-BTB and pHBc3-BTB respect- ively.

Expression and purification of chimeric proteins. Escherichia coli strain TOP10 was transformed with the six plasmids separately and selected on Luria–Bertani plates containing ampicillin (50 lg/ml). After 12–18 h of incubation at 37 °C, the high expression colony was picked and expan- ded in Luria–Bertani medium overnight at 37 °C for small-scale culture. The overnight culture (100 ml) was then inoculated into 1000 ml of the fresh medium des- cribed above at 37 °C until the optical density (OD) (A600) reached 0.4–0.8, and protein expression was induced by supplementing with 0.02% L-Arabinose. After 4–8 h, cells were harvested by centrifugation, resus- pended in 50–100 ml of Tris–EDTA buffer (50 mM Tris–HCl, 10 mM EDTA, pH 8.0), and the suspension was sonicated on ice for 3 min five times and centrifuged at 12,000 g for 20 min. After centrifugation, the proteins in the supernatant were precipitated with ammonium sulphate and the precipitate was resuspended in a min- imal volume of Tris–EDTA buffer. The resuspended pro- tein pellet was dialysed extensively against the same buffer and centrifuged, and the supernatant was recov- ered. The expressed proteins was isolated as previously described [31]with some modifications. The supernatant was filtered through a 0.22-lm filter and loaded at room temperature onto a Ni2+–NTA–agarose column. The col- umn was washed with 10 column volumes of buffer A (20 mM Tris–HCl, pH 7.9, 0.5 M NaCl, 10% glycerol). The proteins were eluted with a 50-ml linear gradient of imidazole (20–500 mM) in buffer A. Fifty fractions (1 ml each) were collected and subjected to SDS-PAGE (15% gel). The fractions containing interest protein were pooled and concentrated using an Amicon positive- pressure ultrafiltration system (MilliPore, Billerica, MA, USA). The GST fusion protein encoded by pET28a–

GST–BTB, GST–BTB, served as control antigen in the immunization experiments.

Phagocytosis of recombinant VLP in vitro. A six-well plate with coverslip (20 mm · 20 mm) was seeded with suspensions of the mouse monocyte macrophage cell line RAW264.7 in DMEM containing 10% FCS and 1.5 mM L-glutamine, 100 units/ml penicillin and 100 lg/ml streptomycin to give approximately 80% confluence after overnight incubation. Proteins (PHBc1-BT, PHBc2-BT, PHBc3-BT, PHBc1-BTB, PHBc2-BTB and PHBc3- BTB) were suspended and added to monolayers at a con- centration of 50 lg per well.

Following incubation for 6 h, coverslips were washed to remove excess proteins and fixed with cold acetone for 15 min at room temperature. Cells were permeabilized by treatment with permeabilization buffer (PBS, 0.25% Tri- ton X-100, 0.5% DMSO) for 10 min. After washing three times, non-specific reactive sites were blocked by incuba- tion with 2% BSA in PBS for 2 h and cells were then incubated overnight at 4 °C with 1:500 dilution of mono- clonal antibody anti-HBc C8A038M (Biodesign, Sydney, Australia). Bound antibody was detected after a further incubation for 1 h at room temperature with 1:1000 dilu- tion of FITC-conjugated goat anti-mouse IgG (Novagen, Darmstadt, Germany). Washed cells were then viewed by fluorescence microscopy (Olympus, Tokyo, Japan).

Immunization of mice. Fifty-six mice (BALB/c, obtained from Animal Center of Second Military Medical Univer- sity, Shanghai, China) were divided into seven groups, using eight animals per group and kept under standard pathogen-free conditions. Eight groups of mice were immunized subcutaneously on days 0, 14 and 28 with 50 lg of PHBc1-BT, PHBc2-BT, PHBc3-BT, PHBc1- BTB, PHBc2-BTB, PHBc3-BTB and GST-BTB respect- ively. Mice were primed with antigen emulsified in Freund’s complete adjuvant followed by boosters with antigen in Freund’s incomplete adjuvant. Serum samples were collected at an interval of 2 weeks and saved. Mice were killed at day 56 and spleens of the animals were used for proliferation assay.

Peptide-specific IgG responses. Evaluation of peptide-spe- cific antibody production was performed by an indirect ELISA (iELISA) using 96-well flat-bottomed plates (Nunc, Roskilde, Denmark). Wells were coated with 50 ll of a 10 lg/ml solution of KLH conjugated VP1141-160peptide (Bootech, Shanghai, China) in a 0.05 M Na2CO3 buffer, pH 9.6, overnight at 4 °C. Prior to the assay, plates were washed five times with phosphate-buffered saline contain- ing 0.05% Tween 20 (PTA) and 0.1% bovine serum albu- min (BSA) per well. The plates were blocked with 5% BSA–PBS for 1 h at 37 °C and then washed as described above. Plates were incubated with serial dilutions of serum samples for 1 h at 37 °C. Another wash was performed under the same conditions described above, followed by the addition of HRP-conjugated Rabbit anti-mouse IgG

Ó 2007 The Authors Journal compilation Ó 2007 Blackwell Publishing Ltd. Scandinavian Journal of Immunology 65, 320–328

Y.-L. Zhang et al. Modified HBc Fused with FMDV Multiepitopes 323..................................................................................................................................................................

(Sigma, St Louis, MO, USA) at 1:2000 dilution and incu- bation for 1 h at 37 °C. A final wash was performed, followed by the substrate (0.01% hydrogen peroxide in phosphate/citrate buffer). Antibody titers were expressed as the reciprocal of the highest serum dilution with an optical density value at three times. The OD was deter- mined at 492 nm.

Detection of virus-specific antibodies using the indirect enzyme-linked immunosorbent assay. Detection of serum antibodies to the FMDV was performed by an iELISA as previously described [32]. Briefly, 96-well flat-bottomed plates (Nunc) coated with FMDV O1K inactivated by formaldehyde in 0.1 M carbonate/bicarbonate buffer, pH 9.6, overnight at 4 °C. After being blocked with 5% BSA–PBS, plates were incubated with serial dilutions of serum samples for 1 h at 37 °C. HRP-conjugated Rabbit anti-mouse IgG (Sigma) at 1:2000 dilution was then added for 1 h at 37 °C, followed by the substrate (0.01% hydrogen peroxide in phosphate/citrate buffer). Antibody titers were expressed as the reciprocal of the highest serum dilution with an OD value at three times. The OD was determined at 492 nm.

HBc-specific IgG responses. Detection of serum antibodies to the HBc was performed by an iELISA, 96-well flat-bot- tomed plates (Nunc) coated with recombinant HBc in 0.1 M carbonate/bicarbonate buffer, pH 9.6, overnight at 4 °C. After being blocked with 5% BSA–PBS, plates were incubated with serial dilutions of serum samples for 1 h at 37 °C. HRP-conjugated Rabbit anti-mouse IgG (Sigma) at 1:2000 dilution was then added for 1 h at 37 °C, fol- lowed by the substrate (0.01% hydrogen peroxide in phos- phate/citrate buffer). Antibody titers were expressed as the reciprocal of the highest serum dilution with an OD value at three times. The OD was determined at 492 nm.

Cytokine production and assay. The splenocytes were adjusted to a concentration of 1 · 106 cells/ml before being cultured in round-bottomed microwell plates in RPMI-1640 medium. Splenocytes from seven mice in each group were tested for cytokine response to 10 lg/ml of homologous type O viral whole protein (FMDV capsid protein, purchased from Lanzhou Veterinary Institute; LPS < 10 ng/ml). The cytokine assay performed as described previously [33]. Supernatants were harvested after 24 h (interleukin-4, IL-4) and 72 h (IFN-c), when peak values of the respective cytokines could be meas- ured. Supernatants from at least three separate wells were pooled and assayed for the presence of cytokine by an ELISA, using commercialized kit (Jingmei Biotech, Shanghai, China). A range of dilutions of purified recom- binant mouse IFN-c, IL-4 were included as standards.

Lymphocyte proliferation assay. The immunogenicity was also assayed by the proliferous ability of immunized splenocytes in vitro, as described elsewhere. In brief, seven mice of each group were killed on day 56 after the first immunization and the spleen were isolated sterilely. The splenocytes of each group were pooled together. The splenocytes (1 · 106 per ml) were incubated with 10 lg/ ml of HBc or homologous type O viral whole protein in triplicate wells of flat-bottomed plates (Nunc) respect- ively. Cells cultivated in medium alone served as negative control. The plates were incubated in a 5% CO2 humid- ified incubator at 37 °C. OD570 was measured after 3 days by a standard 3-(4,5-dimethylthiazol-2-yl)-2,5-di- phenyltetrazo-lium bromide (MTT) method. The results were expressed as the value of stimulation index (SI). SI value was calculated as the ratio of absorbent value at 570 nm of pools incubated with viral whole protein to that of pools incubated with medium only.

Ó 2007 The Authors
Journal compilation Ó 2007 Blackwell Publishing Ltd. Scandinavian Journal of Immunology 65, 320–328

324 Modified HBc Fused with FMDV Multiepitopes Y.-L. Zhang et al...................................................................................................................................................................

Statistical analysis. The Kruskal–Wallis non-paramet- ric rank sum test and Wilcoxon’s matched pairs test were used to test the significance of differences in humoral and cellular immune responses. An analysis of variance (ANOVA) was also performed. Data were analysed using SAS 8.2 (SAS Institution Inc., Cary, NC, USA). A value of P < 0.05 was considered significant.

Results
Formation of recombinant VLP

Only the protein PHBc3-BTB was soluble in six recom- binant proteins expressed in E. coli TOP10. The other five proteins were found in the inclusion body (Fig. 2A). These His-tagged proteins were purified by Ni2+–NTA– agarose column, and the purities of interest proteins were above 90%. The expressions of HBc chimeric proteins were confirmed by Western blot analysis using an anti- HBcAg MoAb (Fig. 2B). VLP formation of the protein PHBc3-BTB was confirmed directly by negative staining electron microscopy (EM) (Fig. 3), while the proteins PHBc1-BT, PHBc2-BT, PHBc3-BT, PHBc1-BTB and PHBc2-BTB failed to form VLP.

Recombinant VLP was phagocytosed by RAW264.7 in vitro

Six recombinant proteins were added to monolayers of RAW264.7 cells to determine whether VLP formation was more potent to be phagocytosed than non-particle proteins. The phagocytosis was detectable in the RAW264.7 incubated with PHBc3-BTB VLP, while

there was no marked fluorescence detected in the cells incubated with non-particle proteins (Fig. 4).

Enhanced humoral and cellular immune responses

To evaluate the immune responses induced by subcuta- neous administrations of six chimeric proteins alone or in conjunction with an adjuvant, HBc-specific IgG, peptide- specific IgG and virus-specific antibodies were measured by an iELISA on weeks 2, 4, 6 and 8 after the first immunization. Six recombinant proteins were compared with GST-BTB in their potential to induce specific anti- bodies also. The PHBc3-BTB VLP induced higher titers of anti-HBc antibodies even without adjuvant, while

Ó 2007 The Authors Journal compilation Ó 2007 Blackwell Publishing Ltd. Scandinavian Journal of Immunology 65, 320–328

Y.-L. Zhang et al. Modified HBc Fused with FMDV Multiepitopes 327..................................................................................................................................................................

response than those from mice immunized with other chimeric proteins and GST-BTB, especially immunized with PHBc3-BTB emulsified in Freund’s adjuvant (Fig. 7A) (P < 0.01). All the results were consistent with peptide and virus-specific antibodies production, demon- strating that PHBc3-BTB VLP could elicit augmented humoral and cellular responses.

Discussion

An important consideration for designing vaccines based on defined peptides from complex protein antigens is their optimal delivery to the immune system to produce maximal antibody response and cellular responses, in both qualitative and quantitative terms. This require- ment has resulted in the development of various poly- meric presentation systems based on recombinant DNA technology, for example, the HBV core particle [34]. The HBcAg is a highly symmetric structure formed by multiple dimers of single-core protein subunit. These factors make HBcAg an unusually strong immunogen and an attractive candidate as a carrier for foreign epi- topes. The immunodominant c/e1 epitope (MIR) on the capsid protein has been suggested to be a superior loca- tion to convey high immunogenicity to a heterologous sequence [7].

The major aim of the study was to analyse VLP for- mation and assess the principal possibility of using HBcAg as a basis for the construction of chimeric pro- tein bearing fragment of FMDV. In the current study, we examined whether chimeric HBc/FMDVepitopes pro- tein molecules were able to form regular and uniform VLP and whether the inserted fragments of FMDV epitopes proteins retained their immunogenicity. Retain- ing self-assembly competence is of utmost importance for the construction of vaccine candidates, as only correct spatial VLP organization may provide high density, high symmetry and correct targeting of inser- ted foreign sequences and ensure the desired immunolo- gical and delivery properties of the resulting VLP products.

Unfortunately, the insertion of FMDV VP1 aa 141– 160 at MIR did not lead to the formation of regular, mature particles (data not shown). To avoid it in the study of HBV vaccine, researchers inserted HBV preS2 B-cell epitopes into MIR deleted aa 76–80, aa 79–81, and ideal immune effects were obtained. According to the general consensus, one of the critical issues related to the VLP technology is the strict necessity to control the presence of packaged nucleic acids within the resulting particles. The lack of co-purified indefinite nucleic acids is one of the most important prerequisites of modern vac- cine production.

Here, for these reasons, we constructed HBcAg-based particles with shortened nucleic acid-binding motifs (aa

1–144). Then, three display vectors were constructed by deletions of different lengths within MIR, aa 75–78, aa 75–80 and aa 75–82. The three plasmids without any insertion were well expressed and largely soluble in E. coli, and regular particle formations were confirmed by EM. However, these plasmids inserted multiepitopes BT[VP1(141–160)–VP4(21–40)] did not express protein in soluble form and form regular particles. The PHBc1-BTB and PHBc2-BTB proteins were expressed in inclusion body also. Only PHBc3-BTB protein was soluble and formed mature VLP. It showed that the inserted fragment, even if it is very small, could des- troy the self-assembly of HBc particle. Reasons for these negative results are not completely understood. However, a computer modelling suggested that the insertion of the chosen FMDV sequences at MIR might have caused a number of critical changes in the secon- dary structure of the c/e1 loop and the flanking sequences of HBc protein monomers, thus preventing the assembly of chimeric dimers into mature regular particles.

Analysis of the immune responses to the FMDV epi- topes of chimeric proteins revealed significant, although somewhat unexpected results. After immunization of mice with non-particle recombinant proteins, we observed evident antibody and proliferative responses to HBcAg, but not to homologous type O viral whole pro- tein. In contrast, recombinant VLP were able to mount high humoral and cellular responses both to HBcAg and homologous type O viral whole protein, and usage of adjuvant enhanced these effects markedly. The reasons for the revealed discrepancy in the immunogenic potentials of different HBc/FMDV chimeric proteins might lie in VLP formation, which in favour of displaying naturally heterologous epitopes on it and presenting antigens by antigen-presenting cells.

At present, we still do not have a more or less reliable technique at our disposal to predict whether particular chimeric HBc protein dimers would be able to self- assemble with the formation of regular virus-like struc- tures, and every new chimeric construct has to be explored using the experimental approach. We expect that the data accumulated in the current study would complement the already available information on other chimeric constructs and contribute to our understanding of the mechanisms of morphogenesis and assembly of chi- meric HBcAg-based particles.

Acknowledgment

This work was funded by National High Technology Research and Development Program (863 Program, no. 2001AA213111) from the Ministry of Science and Tech- nology, Key Program (no. 30530660) from National Natural Science Foundation of China.

Ó 2007 The Authors
Journal compilation Ó 2007 Blackwell Publishing Ltd. Scandinavian Journal of Immunology 65, 320–328

328 Modified HBc Fused with FMDV Multiepitopes Y.-L. Zhang et al...................................................................................................................................................................

References

1. 1  Birnbaum F, Nassal M. Hepatitis B virus nucleocapsid assembly: primary structure requirements in the core protein. J Virol 1990;64:3319–30.

2. 2  Newnan M, Suk FM, Cajimat M, Chua PK, Shih C. Stability and morphology comparisons of self-assembled virus-like particles from wild-type and mutant human hepatitis B virus capsid proteins. J Virol 2003;77:12950–60.

3. 3  Watts NR, Conway JF, Cheng N, Stahl SJ, Belnap DM, Steven AC. The morphogenic linker peptide of HBV capsid protein forms a mobile array on the interior surface. Embo J 2002;21:876–84.

4. 4  Hatton T, Zhou S, Standring DN. RNA- and DNA-binding activ- ities in hepatitis B virus capsid protein: a model for their roles in viral replication. J Virol1992;66:5232–41.

5. 5  Nassal M. The arginine-rich domain of the hepatitis B virus core protein is required for pregenome encapsidation and productive viral positive-strand DNA synthesis but not for virus assembly. J Virol 1992;66:4107–16.

6. 6  Newton SE, Clarke BE, Appleyard G, Francis MJ, Carroll AR, Rowlands DJ. New approaches to FMDV antigen presentation using vaccinia virus. In: Chanock RM, Lerner RA, Brown F, Ginsberg H, eds. Vaccines 87. Modern Approaches to New Vaccines: Prevention of AIDS and other Viral, Bacterial and Parasitic Diseases. Cold Spring Harbor: Cold Spring Harbor Laboratory, 1987:12–21.

7. 7  Pumpens P, Grens E. HBV core particles as a carrier for B cell/T cell epitopes. Intervirology 2001;44:98–114.

8. 8  Ulrich R, Nassal M, Meisel H, Kruger DH. Core particles of hepa- titis B virus as carrier for foreign epitopes. Adv Virus Res 1998;50:141–82.

9. 9  Schodel F, Moriarty AM, Peterson DL, Zheng JA, Hughes JL, Will H. The position of heterologous epitopes inserted in hepatitis B virus core particles determines their immunogenicity. J Virol 1992; 66:106–14.

10. 10  Kratz PA, Bottcher B, Nassal M. Native display of complete foreign protein domains on the surface of hepatitis B virus capsids. Proc Natl Acad Sci USA1999;96:1915–20.

11. 11  Schodel F, Weimer T, Will H, Milich D. Recombinant HBV core particles carrying immunodominant B-cell epitopes of the HBV preS2-region. In: Brown F, Chanock RM, Ginsberg HS, Lerner RA, eds. Vaccines 90. Cold Spring Harbor: Cold Spring Harbor Laborat- ory Press, 1990:193–8.

12. 12  Schodel F, Will H, Milich DR. Hybrid hepatitis-B virus core/pre-S particles expressed in live attenuated Salmonellae for oral immuniza- tion. In: Brown F, Chanock RM, Ginsberg HS, Lerner RA, eds. Vaccines 91. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, 1991:319–25.

13. 13  von Brunn A, Reichhuber C, Brand M, Be chowsky B, Gurtler L, Eberle J. The principal neutralizing determinant (V3) of HIV-1 induces HIV-1-neutralizing antibodies upon expression on HBcAg particles. In: Ginsberg HS, Brown F, Chanock RM, Lerner RA, eds. Vaccines 93. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, 1993:159–65.

14. 14  von Brunn A, Brand M, Reichhuber C, Morys-Wortmann C, Dein- hardt F, Schodel F. Principal neutralizing domain of HIV-1 is highly immunogenic when expressed on the surface of hepatitis B core particles. Vaccine 1993;11:817–24.

15. 15  Borisova G, Borschukova O, Skrastina D, Mezule G, Dislers A, Pet- rovskis I. Display vectors. I. Hepatitis B core particle as a display moiety. Proc Latv Acad Sci 1997;51:1–7.

16. 16  Borschukova O, Skrastina D, Dislers A, Petrovskis I, Ose V, Zam- urujeva I. Modified hepatitis B core particles as possible vaccine car- riers. In: Brown F, Burton D, Doherty P, Mekalanos J, Norrby E, eds. Vaccines 97. Cold Spring Harbor: Cold Springer Harbor Labor- atory Press, 1997:33–7.

17 Borisova G, Borschukova O, Skrastina D, Dislers A, Ose V, Pum- pens P. Behavior of a short preS1 epitope on the surface of hepatitis B core particles. Biol Chem 1999;380:315–24.

18 Sobrino F, Domingo E. Foot-and-mouth disease in Europe. FMD is economically the most important disease of farm animals. Its re-emergence in Europe is likely to have consequences that go beyond severe alterations of livestock production and trade. EMBO Rep 2001;2:459–61.

19 Sobrino F, Domingo E. Foot-and-mouth disease. In: Current Perspec- tives. Norfolk, UK: Horizon Bioscience, 2004.

20 Pereira HG. Foot-and-mouth disease. In: Gibbs EPJ, ed. Virus Dis- ease of Food Animals. London: Academic Press Inc., 1981:333–63.
21 Bachrach HL. Foot-and-mouth disease virus, properties, molecular

biology and immunogenicity. In: Romberger JA, ed. Beltsville Sym- posia in Agricultural Research. Osmun, Montclair, NJ: Allanheld, 1977:3–32.

22 Belsham GJ, Martnez-Salas E. Genome organization, translation and replication of foot-and-mouth disease virus. In: Sobrino F, Domingo E, eds. Foot-and-Mouth Disease. Current Perspectives. Norfolk, UK: Horizon Bioscience, 2004.

23 Crowther JR, Farias S, Carpenter WC, Samuel AR. Identification of a fifth neutralizable site on type O foot-and-mouth disease virus fol- lowing characterization of single and quintuple monoclonal anti- body escape mutants. J Gen Virol 1993;74:1547–53.

24 Kitson JDA, McCahon D, Belsham GJ. Sequence analysis of mono- clonal antibody resistant mutants of type O foot-and-mouth disease virus: evidence for the involvement of the three surface exposed cap- sid proteins in four antigenic sites. Virology 1990;179:26–34.

25 Bittle JL, Houghen RA, Alexander H et al. Protection against foot- and-mouth disease by immunization with a chemically synthesized peptide predicted from the viral nucleotide sequence. Nature 1983;298:30–3.

26 Blanco E, Garcia-Briones M, Sanz-Parra A et al. Identification of T-cell epitopes in nonstructural proteins of Foot-and-mouth disease virus. J Virol2001;75:3164–74.

27 Blanco E, McCullough K, Summerfield A et al. Interspecies major histocompatibility complex-restricted. The cell epitope on foot-and- mouth disease virus capsid protein VP4. J Virol 2000;74:4902–7.

28 van Lierop MJ, Wagenaar JP, van Noort JM, Hensen EJ. Sequences derived from the highly antigenic VP1 region 140 to 160 of foot- and-mouth disease virus do not prime for a bovine T-cell response against intact virus. J Virol 1995;69:4511–4.

29 Perez Filgueira M, Wigdorovitz A, Romera A, Zamorano P, Borca MV, Sadir AM. Detection and characterization of functional T-cell epitopes on the structural proteins VP2, VP3, and VP4 of foot and mouth disease virus O1 campos. Virology 2000;271:234–9.

30 Hoover DM, Lubkowski J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. Nucleic Acids Res 2002;30:e43.

31 Shire SJ, Bock L, Ogez J, Builder S, Kleid D, Moore DM. Purifica- tion and immunogenicity of fusion VP1 protein of foot and mouth disease virus. Biochemistry1984;23:6474–80.

32 Capozzo AV, Periolo OH, Robiolo B, Seki C, LaTorre JL, Grigera PR. Total and isotype humoral responses in cattle vaccinated with foot-and-mouth disease virus (FMDV) immunogen produced either in bovine tongue tissue or in BHK-21 cell suspension cultures. Vac- cine 1997;15:624–30.

33 Zhang HY, Sun SH, Guo YJ et al. Immune response in mice inocu- lated with plasmid DNAs containing multiple-epitopes of foot-and- mouth disease virus. Vaccine2003;21:4704–7.

34 Francis MJ, Hastings GZ, Bronw AL et al. Immunological proper- ties of hepatitis B core antigen fusion proteins. Proc Natl Acad Sci USA 1990;87:2545–9.

Ó 2007 The Authors Journal compilation Ó 2007 Blackwell Publishing Ltd. Scandinavian Journal of Immunology 65, 320–328