Enhanced Immunogenicity of Modified Hepatitis B Virus Core P

Enhanced Immunogenicity of Modified Hepatitis B Virus Core Particle Fused with Multiepitopes of Foot-and-Mouth Disease Virus

Y.-L. Zhang, Y.-J. Guo, K.-Y. Wang, K. Lu, K. Li, Y. Zhu & S.-H. Sun

Department of Medical Genetics, Second Military Medical University, Shanghai, China

Received 11 October 2006; Accepted in revised form 15 December 2006

Correspondence to: S.-H. Sun, Department of Medical Genetics, Second Military Medical University, 800 Xiang’Yin Road, Shanghai 200433, China. E-mail: shsun@vip.sina.com

Abstract

Hepatitis B virus core (HBc) particles, self-assemble into capsid particles and are extremely immunogenic, hold promise as an immune-enhancing vaccine carrier for heterologous antigens. However, formation of virus-like particles (VLP) can be restricted by size and structure of heterlogous antigens. In the study, we investigated formation of VLP by modified HBc fused with specified foot-and-mouth disease virus (FMDV) multiepitopes and evaluated their immune effects. Firstly, three HBc display vectors (pHBc1, pHBc2 and pHBc3) were constructed by deletions of different lengths within the HBc c/e1 region: 75–78 amino acid (aa), 75–80 aa and 75–82 aa respectively. Sec- ondly, we inserted different compositions of FMDV multiepitopes, BT [VP1(141–160)–VP4(21–40)] and BTB [VP1(141–160)–VP4(21–40)– VP1(141–160)], into modified regions. As a result, only plasmid pHBc3-BTB of six recombinant vectors was expressed as soluble protein, which resulted in the formation of complete VLP confirmed by electron microscopy. Recombin- ant VLP could be taken up by cells and presented in vitro and in vivo. Further- more, the modified VLP displayed a significantly stronger immunogenicity than other five recombinant proteins and GST-BTB with a higher titer of pep- tide-specific and virus-specific antibody, elevated IFN-c and interleukin-4 pro- duction, especially enhanced lymphocyte proliferation. The results encourage further work towards the development of FMDV vaccines using hepatitis B virus core particles fused with FMDV epitopes.

Introduction

The icosahedral nucleocapsids of hepatitis B virus (HBV), serologically defined as HBcAg, consist of 180 (triangula- tion number, T 1⁄4 3) or 240 subunits (T 1⁄4 4) of a single 183-amino acid (aa) core protein. The first 140 aa are suffi- cient for particle assembly [1, 2], the dispensable C ter- minal region is rich in Arg residues and binds to nucleic acids [3–5]. Hepatitis B core particles were firstly reported as a promising virus-like particle (VLP) carrier in 1986 [6]. Being one the first VLP candidates and the first icosa- hedral VLP carrier, the HBc particles remain the most flexible and the most promising model for knowledge- based display of foreign peptide sequences up to now. In many ways, HBc holds a unique position among other VLP carriers because of its high-level expression and effi- cient particle formation in virtually all known homologous and heterologous expression systems, including bacteria.

The small loop connecting the central helices overlap- ping the c/e1 epitopes has been identified as a superior site for insertion of heterologous sequences. While some short peptide inserts were tolerated, attempts to insert FMDV VP1(141–160 aa) frequently abolished VLP for- mation, suggesting that the loop has a naturally limited property of inserted fragment [7, 8].

Special interest is now devoted to construction of HBc display vectors with deletions of different lengths within c/e1 region (major immunogenic region, MIR), such as aa 76–80 [9–12], aa 79–80 [13, 14]. Structural and numerous experimental [15–17] data convinced us that the region between the two conserved glycines G73 and G94 can be used as target for deletions, rearrangements and substitutions. For optimal immunogenicity of the insert, it is extremely important that deleting proper aa residues within this region abrogate the intrinsic HBc antigenicity/immunogenicity [16, 17].

Ó 2007 The Authors 320 Journal compilation Ó 2007 Blackwell Publishing Ltd. Scandinavian Journal of Immunology 65, 320–328

Y.-L. Zhang et al. Modified HBc Fused with FMDV Multiepitopes 321..................................................................................................................................................................

Foot-and-mouth disease virus (FMDV) is the causative agent of one of the most transmissible diseases of live stock, which causes severe outbreaks and important eco- nomic losses worldwide [18–20]. This picornavirus is composed of a single RNA strand and a capsid assembled from 60 units of the four structural proteins designated VP1, 2, 3 and 4 respectively [21, 22]. Five sites contain- ing B-cell epitopes were defined on these proteins through monoclonal antibody escape mutant studies [23, 24]. Site 1 is the predominant site encoding two VP1 epitopes (residues 141–160 and 200–213 of VP1), which was able to protect animals from viral attack [25]. Epi- tope141-160 is linear, so it is easy to be mimicked for site 1 than other four sites that are conformational or less conformational dependent. Two major T helper epitopes identified in natural hosts, which are located in the non-structural protein 3A (T3A) [26] and in the VP4 structural protein (TVP4) [27, 28]. The latter epitope (aa 21–40) is an ideal candidate to be included in a vaccine formulation against FMDV as it seems to be recognized not only in natural hosts but also in BALB/c mice [29].

Here, we constructed three display vectors by modifi- cation of HBc to enhance capacity of displaying heterolo- gous fragment. Meanwhile, two different multiepitopes BT[VP1(141–160)–VP4(21–40)] and BTB [VP1(141– 160)–VP4(21–40)–VP1(141–160)] were synthetized. Recombinant plasmids were expressed to obtain proteins in Escherichia coli. The structure and immunogenicity of six proteins were investigated. Furthermore, the mecha-

nisms of immunopotentiation were also researched in this study.

Materials and methods

Construction of expression vectors. Six plasmids were con- structed in frame with HBc to investigate the structure and immune effect of HBc chimeric proteins. These plas- mids encode a truncated HBc gene (aa 1–144) with the tandem epitopes (BT or BTB) inserted in the HBc c/e1 region between aa 74 and 79, 74 and 81, 74 and 83 respectively (Fig. 1). HBc particles engineered to present heterologous epitopes have historically been truncated at, or around, aa 144 to avoid incorporation of host RNA by the protamine rich C-terminal tail (aa 150–183).

Display vectors (pHBc1, pHBc2 and pHBc3) were constructed as follows. First, the amino terminus of the pMD-HBc containing truncated HBc gene (aa 1–144) was amplified using two PCR primers to produce a dsDNA fragment corresponding to HBc aa 1–74, flanked with NcoI and BbeI restriction sites. The PCR primers used for amplification were HBc-P1/NcoI-F (5¢-CATGC- CATGGATGGACATTGACCCG) and HBc-P74/BbeI-R (5¢-ATTACTTCCCACCCAGGTGGGGCGCC). A plas- mid pBAD1 was constructed when the PCR fragment was inserted into plasmid pBAD, which had been pre- pared by cutting with the same two restriction enzymes (NcoI and BbeI). Second, The C-terminal of pMD-HBc was amplified, respectively, using four PCR primers to

Figure 1 Schematic presentation of the chimeric HBc/FMDV constructs used in the study.

Ó 2007 The Authors
Journal compilation Ó 2007 Blackwell Publishing Ltd. Scandinavian Journal of Immunology 65, 320–328

322 Modified HBc Fused with FMDV Multiepitopes Y.-L. Zhang et al...................................................................................................................................................................

produce three dsDNA fragments corresponding to HBc aa 79–144, 81–144 and 83–144, flanked with BbeI_Sac1 and Xho1. The primers were HBc-P79/BbeI_Sac1- F(GGCGCCGAGCTCGCATCCAGGGAATTAG), HBc- P81/BbeI_Sac1-F(GGCGCCGAGCTCAGGGAATTAGTAG), HBc-P83/BbeI_Sac1-F(GGCGCCGAGCTCTTAGTAGT- CAGCTATG) and HBc-P144/Xho1-R (CGGAAGTGTT- GATAAGATAGCTCGAGGG). The three PCR fragments were inserted, respectively, into pBAD1, which had been prepared by the same two restriction enzymes (BbeI and Xho1). Then, the pHBc1, pHBc2 and pHBc3 were constructed.

DNAworks2.4 [30], automatic oligonucleotide design for PCR-based gene synthesis, was applied to synthesize multiepitopes BT and BTB. Meanwhile, some flexibility linkers were inserted into epitopes bilateralis.

At last, multiepitopes, BT and BTB, were inserted into pHBc1, pHBc2 and pHBc3 to construct six recom- binant plasmids pHBc1-BT, pHBc2-BT, pHBc3-BT, pHBc1-BTB, pHBc2-BTB and pHBc3-BTB respect- ively.

Expression and purification of chimeric proteins. Escherichia coli strain TOP10 was transformed with the six plasmids separately and selected on Luria–Bertani plates containing ampicillin (50 lg/ml). After 12–18 h of incubation at 37 °C, the high expression colony was picked and expan- ded in Luria–Bertani medium overnight at 37 °C for small-scale culture. The overnight culture (100 ml) was then inoculated into 1000 ml of the fresh medium des- cribed above at 37 °C until the optical density (OD) (A600) reached 0.4–0.8, and protein expression was induced by supplementing with 0.02% L-Arabinose. After 4–8 h, cells were harvested by centrifugation, resus- pended in 50–100 ml of Tris–EDTA buffer (50 mM Tris–HCl, 10 mM EDTA, pH 8.0), and the suspension was sonicated on ice for 3 min five times and centrifuged at 12,000 g for 20 min. After centrifugation, the proteins in the supernatant were precipitated with ammonium sulphate and the precipitate was resuspended in a min- imal volume of Tris–EDTA buffer. The resuspended pro- tein pellet was dialysed extensively against the same buffer and centrifuged, and the supernatant was recov- ered. The expressed proteins was isolated as previously described [31]with some modifications. The supernatant was filtered through a 0.22-lm filter and loaded at room temperature onto a Ni2+–NTA–agarose column. The col- umn was washed with 10 column volumes of buffer A (20 mM Tris–HCl, pH 7.9, 0.5 M NaCl, 10% glycerol). The proteins were eluted with a 50-ml linear gradient of imidazole (20–500 mM) in buffer A. Fifty fractions (1 ml each) were collected and subjected to SDS-PAGE (15% gel). The fractions containing interest protein were pooled and concentrated using an Amicon positive- pressure ultrafiltration system (MilliPore, Billerica, MA, USA). The GST fusion protein encoded by pET28a–

GST–BTB, GST–BTB, served as control antigen in the immunization experiments.

Phagocytosis of recombinant VLP in vitro. A six-well plate with coverslip (20 mm · 20 mm) was seeded with suspensions of the mouse monocyte macrophage cell line RAW264.7 in DMEM containing 10% FCS and 1.5 mM L-glutamine, 100 units/ml penicillin and 100 lg/ml streptomycin to give approximately 80% confluence after overnight incubation. Proteins (PHBc1-BT, PHBc2-BT, PHBc3-BT, PHBc1-BTB, PHBc2-BTB and PHBc3- BTB) were suspended and added to monolayers at a con- centration of 50 lg per well.

Following incubation for 6 h, coverslips were washed to remove excess proteins and fixed with cold acetone for 15 min at room temperature. Cells were permeabilized by treatment with permeabilization buffer (PBS, 0.25% Tri- ton X-100, 0.5% DMSO) for 10 min. After washing three times, non-specific reactive sites were blocked by incuba- tion with 2% BSA in PBS for 2 h and cells were then incubated overnight at 4 °C with 1:500 dilution of mono- clonal antibody anti-HBc C8A038M (Biodesign, Sydney, Australia). Bound antibody was detected after a further incubation for 1 h at room temperature with 1:1000 dilu- tion of FITC-conjugated goat anti-mouse IgG (Novagen, Darmstadt, Germany). Washed cells were then viewed by fluorescence microscopy (Olympus, Tokyo, Japan).

Immunization of mice. Fifty-six mice (BALB/c, obtained from Animal Center of Second Military Medical Univer- sity, Shanghai, China) were divided into seven groups, using eight animals per group and kept under standard pathogen-free conditions. Eight groups of mice were immunized subcutaneously on days 0, 14 and 28 with 50 lg of PHBc1-BT, PHBc2-BT, PHBc3-BT, PHBc1- BTB, PHBc2-BTB, PHBc3-BTB and GST-BTB respect- ively. Mice were primed with antigen emulsified in Freund’s complete adjuvant followed by boosters with antigen in Freund’s incomplete adjuvant. Serum samples were collected at an interval of 2 weeks and saved. Mice were killed at day 56 and spleens of the animals were used for proliferation assay.

Peptide-specific IgG responses. Evaluation of peptide-spe- cific antibody production was performed by an indirect ELISA (iELISA) using 96-well flat-bottomed plates (Nunc, Roskilde, Denmark). Wells were coated with 50 ll of a 10 lg/ml solution of KLH conjugated VP1141-160peptide (Bootech, Shanghai, China) in a 0.05 M Na2CO3 buffer, pH 9.6, overnight at 4 °C. Prior to the assay, plates were washed five times with phosphate-buffered saline contain- ing 0.05% Tween 20 (PTA) and 0.1% bovine serum albu- min (BSA) per well. The plates were blocked with 5% BSA–PBS for 1 h at 37 °C and then washed as described above. Plates were incubated with serial dilutions of serum samples for 1 h at 37 °C. Another wash was performed under the same conditions described above, followed by the addition of HRP-conjugated Rabbit anti-mouse IgG

Ó 2007 The Authors Journal compilation Ó 2007 Blackwell Publishing Ltd. Scandinavian Journal of Immunology 65, 320–328

Y.-L. Zhang et al. Modified HBc Fused with FMDV Multiepitopes 323..................................................................................................................................................................

(Sigma, St Louis, MO, USA) at 1:2000 dilution and incu- bation for 1 h at 37 °C. A final wash was performed, followed by the substrate (0.01% hydrogen peroxide in phosphate/citrate buffer). Antibody titers were expressed as the reciprocal of the highest serum dilution with an optical density value at three times. The OD was deter- mined at 492 nm.

Detection of virus-specific antibodies using the indirect enzyme-linked immunosorbent assay. Detection of serum antibodies to the FMDV was performed by an iELISA as previously described [32]. Briefly, 96-well flat-bottomed plates (Nunc) coated with FMDV O1K inactivated by formaldehyde in 0.1 M carbonate/bicarbonate buffer, pH 9.6, overnight at 4 °C. After being blocked with 5% BSA–PBS, plates were incubated with serial dilutions of serum samples for 1 h at 37 °C. HRP-conjugated Rabbit anti-mouse IgG (Sigma) at 1:2000 dilution was then added for 1 h at 37 °C, followed by the substrate (0.01% hydrogen peroxide in phosphate/citrate buffer). Antibody titers were expressed as the reciprocal of the highest serum dilution with an OD value at three times. The OD was determined at 492 nm.

HBc-specific IgG responses. Detection of serum antibodies to the HBc was performed by an iELISA, 96-well flat-bot- tomed plates (Nunc) coated with recombinant HBc in 0.1 M carbonate/bicarbonate buffer, pH 9.6, overnight at 4 °C. After being blocked with 5% BSA–PBS, plates were incubated with serial dilutions of serum samples for 1 h at 37 °C. HRP-conjugated Rabbit anti-mouse IgG (Sigma) at 1:2000 dilution was then added for 1 h at 37 °C, fol- lowed by the substrate (0.01% hydrogen peroxide in phos- phate/citrate buffer). Antibody titers were expressed as the reciprocal of the highest serum dilution with an OD value at three times. The OD was determined at 492 nm.

Cytokine production and assay. The splenocytes were adjusted to a concentration of 1 · 106 cells/ml before being cultured in round-bottomed microwell plates in RPMI-1640 medium. Splenocytes from seven mice in each group were tested for cytokine response to 10 lg/ml of homologous type O viral whole protein (FMDV capsid protein, purchased from Lanzhou Veterinary Institute; LPS < 10 ng/ml). The cytokine assay performed as described previously [33]. Supernatants were harvested after 24 h (interleukin-4, IL-4) and 72 h (IFN-c), when peak values of the respective cytokines could be meas- ured. Supernatants from at least three separate wells were pooled and assayed for the presence of cytokine by an ELISA, using commercialized kit (Jingmei Biotech, Shanghai, China). A range of dilutions of purified recom- binant mouse IFN-c, IL-4 were included as standards.